Bioinformatics bites: How do I find primer binding sites?

This week’s bioinformatics bite comes from another actual patron question (paraphrased):

I have all these primers that someone else designed. How to I figure out where they bind and what they amplify?

Disclaimer: this isn’t actually the answer I gave to the person seeking help, but I’ve since found a more efficient tool.

Probably the fastest way to get this information is to use a simple tool called Primer Map.

Conveniently, they have an example primer mapping loaded into the browser:

Map these Primers:

(reverse) aacagctatgaccatg,
(T3) attaaccctcactaaag,
(KS) cgaggtcgacggtatcg,
(SK) tctagaactagtggatc,
(T7) aatacgactcactatag,
(-40) gttttcccagtcacgac,
(Sp6) atttaggtgacactatag,
(M13 for) gtaaaacgacggccagt,
(M13 rev) cacacaggaaacagctatgaccat,
(BGH rev) tagaaggcacagtcgagg,
(pGEX for) ctggcaagccacgtttggtg,
(pGEX rev) ggagctgcatgtgtcagagg,
(T7-EEV aaggctagagtacttaatacga,
(pUC/M13 Forward) gttttcccagtcacgac,
(pUC/M13 forward) cgccagggttttcccagtcacgac,
(pUC/M13 reverse) caggaaacagctatgac,
(pUC/M13 reverse) tcacacaggaaacagctatgac,
(Glprimer1) tgtatcttatggtactgtaactg,
(GLprimer2) ctttatgtttttggcgtcttcca,
(RVprimer3) ctagcaaaataggctgtccc,
(RVprimer4) gacgatagtcatgccccgcg,
(Lambda gt11 Forward) ggtggcgacgactcctggagcccg,
(Lambda gt11 Reverse) ttgacaccagaccaactggtaatg,
(Lambda gt10 Forward) cttttgagcaagttcagcctggttaag,
(lambda gt10 Reverse) gaggtggcttatgagtatttcttccagggta,
(Pinpoint Sequencing) cgtgacgcggtgcagggcg,
(pTarget Sequencing) ttacgccaagttatttaggtgaca

To this sequence:

>sample sequence
cagctggggggaggtggcgaggaagatgacgtggtcgaggtcgacggtatcgagttgtcgcggcagctgccaatacgactcactatagaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatctttagtgagggttaatcacctgctacttctcccgccacctccc

PrimerMapQuery

Once the template is in the top box, and the primers are in the bottom box, hit Submit. (The output gets a lot cleaner if you turn translation and restriction enzyme displays off in the settings.)

The results pop up in a new window. The first results section show where the primers bind, with forward (sense) primers highlighted in purple and reverse (antisense) primers highlighted in orange.

PrimerMapResultsSequence

The second part of the results page show a table with all the primers that you input, highlighting which ones that bound with the color that indicates their orientation:

PrimerMapResultsTable

The only thing that is missing is a their column that indicates the position on the template at which the primers bind. I guess beggars can’t be choosers though.

Next time I’ll show you how to do this using NCBI’s Primer BLAST. This algorithm is actually build for primer design, but it can be hacked for this purpose and provides better visualizations and more information.

  • Tobin Magle, PhD, Biomedical Sciences Research Support Specialist

Leave a Comment

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s