Off-Campus Access is changing!

On August 26, the Health Sciences Library will be making changes to our off-campus proxy system so that you can now log in with your PassportID (this is the same username and password you use for other University resources – like o365 email and the UCDAccess Portal).

Why are we making this change?
Login via PassportID is more secure for you, the user. It will also be far easier for the library to manage. Just one example: in the past there has been a slight delay of up to a week before new students and employees were able to have access to off campus resources. That delay will now disappear.

Here is a screenshot of the new login page that will be in place starting 8 am, Aug. 26 2015 (click to enlarge):

ezproxyNEW

There will be some exceptions:

  • University of Colorado Hospital employees will still need to log in the old way, using their username of:  letter H followed by their UCH employee ID number (eg: Hxxxxxx). Password is user’s last name.
  • Volunteer Clinical Faculty (VCF program) will continue to log in with their assigned ID number as user name and last name as password.

Prefer the old way?

  • As this is a “soft launch” , the old way of logging in will still work for a limited time only: user name as employee ID number, and last name as password.
  • However, if you had a web browser automatically enter your login and password, you will need to clear out the saved password.  If you have any trouble with this, please call our library Service Desk for directions on clearing saved password from various browsers.

 

Difficulty logging in?  Please contact the HSL Service Desk at 303-724-2152 or use Ask Us.

Questions?  Concerns?  Please contact Jeff.Kuntzman@ucdenver.edu

Clinical Corner: Inpatient Glycemic Control

Clinical Corner

Today’s Internal Medicine Morbidity and Mortality Conference focused on a patient with type 1 diabetes who had difficulty with glycemic control during hospitalization. Here are several articles for background information:

  • Inpatient glycemic control: Best practice advice from the Clinical Guidelines Committee of the American College of Physicians. Qaseem A, Chou R, Humphrey LL, Shekelle P; Clinical Guidelines Committee of the American College of Physicians. Am J Med Qual. 2014 Mar-Apr;29(2):95-8. PMID: 23709472. Full text (free to UCD-AMC affiliates).

 

  • Management of hyperglycemia in hospitalized patients in non-critical care setting: An Endocrine Society clinical practice guideline. Umpierrez GE, Hellman R, Korytkowski MT, Kosiborod M, Maynard GA, Montori VM, Seley JJ, Van den Berghe G; Endocrine Society. J Clin Endocrinol Metab. 2012 Jan;97(1):16-38. PMID: 22223765. Full text (free to UCD-AMC affiliates).

 

  • Hospital management of hyperglycemia. Lleva RR, Inzucchi SE. Curr Opin Endocrinol Diabetes Obes. 2011 Apr;18(2):110-8. PMID: 21358407. Full text (free to UCD-AMC affiliates).

 

  • Intensive insulin therapy in hospitalized patients: A systematic review. Kansagara D, Fu R, Freeman M, Wolf F, Helfand M. Ann Intern Med. 2011 Feb 15;154(4):268-82. PMID: 21320942. Full text (free to UCD-AMC affiliates).

 

Three studies were presented at the end of conference as teaching points:

  • Patient communication during handovers between emergency medicine and internal medicine residents. Fischer M, Hemphill RR, Rimler E, Marshall S, Brownfield E, Shayne P, Di Francesco L, Santen SA. J Grad Med Educ. 2012 Dec;4(4):533-7. PMID: 24294436. Free full text.

 

  • Exploring emergency physician-hospitalist handoff interactions: Development of the Handoff Communication Assessment. Apker J, Mallak LA, Applegate EB 3rd, Gibson SC, Ham JJ, Johnson NA, Street RL Jr. Ann Emerg Med. 2010 Feb;55(2):161-70. PMID: 19944486. Full text (free to UCD-AMC affiliates).

 

  • Chart biopsy: An emerging medical practice enabled by electronic health records and its impacts on emergency department-inpatient admission handoffs. Hilligoss B, Zheng K. J Am Med Inform Assoc. 2013 Mar-Apr;20(2):260-7. PMID: 22962194. Free full text.

 

Kristen DeSanto, MSLS, MS, RD, AHIP

Clinical Librarian

kristen.desanto@ucdenver.edu • 303-724-2121

Bioinformatics Bites: Primer BLAST

This week’s bioinformatics bites is going to look over the features of Primer BLAST.

Back in my day (circa 2001-2014), we designed our primers by hand! Most of the places I worked, we’d have a printout of the genomic sequence we were working on that was annotated with transcripts and restriction site. We’d eyeball a good primer site and use OligoAnalyzer to find Tm and hairpins and self annealing and all that. One group I worked in would calculate Tm by counting up all the G’s and multiplying that by 4, then counting all the As and multiplying that by 2, and adding those two numbers together. There was no thought given to contaminating products in the design process. That was all trial and error in the PCR machine.

It was the dark ages.

Luckily, NCBI designed primer BLAST to help you all out. The primary function of this tool is primer design. First, enter a template.

PrimerBlastTemplate

(Click to enlarge images)

First, provide a unique identifier (accession or GI) for a record that’s in GenBank (like the NM_ number for an mRNA) or paste in a nucleotide sequence in FASTA format. i’m going to use the accession number (NM_001302688.1) for the human APOE gene mRNA.

Then, specify where you want your forward (sense) and reverse (antisense) primers to be in that sequence.

Finally, specify information about your primers (Tm) and desired PCR product (length). You can also use this tool to create a matching primer for a preexisting primer. We’ll use the example  5′-GGGAGCCCTATAATTGGACAAG-3′

PrimerBlastPrimerParameters

If you used a refseq mRNA as your template, specify parameters involving introns and exons, such as whether the  primers span an exon-exon junction and how many bases have to match on either side of the junction. You can also specify whether you want the product to span an intron on the genomic DNA.

Primer blast exonintron

Finally, specify how you want the algorithm to check for specificity of your primers by selecting your organism (or possible contaminating organism), the datta base you want to search, target size and specific primer parameters (mismatches etc.) PrimerBLAST specificity

For this demo, I used the template NM_001302688.1 and specified that my forward primer is 5′-GGGAGCCCTATAATTGGACAAG-3′. I also specified that I want the product include on intron. All other values were kept as default. (Another handy feature is that the interface highlights non-default parameters in yellow.)

After clicking submit, a nice graphical summary of the results is displayed. Note that because i specified a forward primer, all the PCR products (in blue) start in the same place:

primer BLAST graphic

For each primer pair, the sequence of both primers, the product length, the size of the intron they span are included. along with information about Tm, length, start and stop positions, and self binding for each primer.

primer blast primer pair

This is where the hack I mentioned last week comes in: because the primer that we entered into the search is also mapped onto the template, Primer BLAST effectively tells you the binding sure of the primer in terms of its position on the transcript we entered as the template. Pretty cool! Changing the template to the DNA accession number that contains this sequence would give us the genomic position of the primer, but we wouldn’t be able to do the cool stuff with introns.

Finally, it displays potential contaminating products you might see with human DNA as the PCR template:

primer blast unintended targets

In this case, it looks like we’d be amplifying another transcript variant of APOE. Definitely something to look out for when doing qPCR!

I hope you find this tool useful. Please let me know if I can help you with using primer BLAST or any other NCBI databases and tools.

  • Tobin Magle, Biomedical Sciences Research Support Specialist

Clinical Corner: Seizure/Epilepsy Videos

Clinical Corner

Cameron Ludt, DO (Neurology PGY-3) gave a presentation at Internal Medicine noon conference last Friday on epilepsy and seizure disorders. A highlight of the presentation was the showing of several videos recorded on the epilepsy monitoring unit, so that students and residents could see firsthand what different types of seizures looked like.

To see even more seizure/epilepsy videos, the Health Sciences Library subscribes to the Neurology Video Textbook (2013), by Jonathan Howard from NYU School of Medicine. Here are the steps to browse and view videos:

Neurology TOC

  • Scroll down the page to view all available videos.

Please contact me for further questions or if you have problems accessing the book.

Kristen DeSanto, MSLS, MS, RD, AHIP

Clinical Librarian

kristen.desanto@ucdenver.edu • 303-724-2121

Bioinformatics bites: How do I find primer binding sites?

This week’s bioinformatics bite comes from another actual patron question (paraphrased):

I have all these primers that someone else designed. How to I figure out where they bind and what they amplify?

Disclaimer: this isn’t actually the answer I gave to the person seeking help, but I’ve since found a more efficient tool.

Probably the fastest way to get this information is to use a simple tool called Primer Map.

Conveniently, they have an example primer mapping loaded into the browser:

Map these Primers:

(reverse) aacagctatgaccatg,
(T3) attaaccctcactaaag,
(KS) cgaggtcgacggtatcg,
(SK) tctagaactagtggatc,
(T7) aatacgactcactatag,
(-40) gttttcccagtcacgac,
(Sp6) atttaggtgacactatag,
(M13 for) gtaaaacgacggccagt,
(M13 rev) cacacaggaaacagctatgaccat,
(BGH rev) tagaaggcacagtcgagg,
(pGEX for) ctggcaagccacgtttggtg,
(pGEX rev) ggagctgcatgtgtcagagg,
(T7-EEV aaggctagagtacttaatacga,
(pUC/M13 Forward) gttttcccagtcacgac,
(pUC/M13 forward) cgccagggttttcccagtcacgac,
(pUC/M13 reverse) caggaaacagctatgac,
(pUC/M13 reverse) tcacacaggaaacagctatgac,
(Glprimer1) tgtatcttatggtactgtaactg,
(GLprimer2) ctttatgtttttggcgtcttcca,
(RVprimer3) ctagcaaaataggctgtccc,
(RVprimer4) gacgatagtcatgccccgcg,
(Lambda gt11 Forward) ggtggcgacgactcctggagcccg,
(Lambda gt11 Reverse) ttgacaccagaccaactggtaatg,
(Lambda gt10 Forward) cttttgagcaagttcagcctggttaag,
(lambda gt10 Reverse) gaggtggcttatgagtatttcttccagggta,
(Pinpoint Sequencing) cgtgacgcggtgcagggcg,
(pTarget Sequencing) ttacgccaagttatttaggtgaca

To this sequence:

>sample sequence
cagctggggggaggtggcgaggaagatgacgtggtcgaggtcgacggtatcgagttgtcgcggcagctgccaatacgactcactatagaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatctttagtgagggttaatcacctgctacttctcccgccacctccc

PrimerMapQuery

Once the template is in the top box, and the primers are in the bottom box, hit Submit. (The output gets a lot cleaner if you turn translation and restriction enzyme displays off in the settings.)

The results pop up in a new window. The first results section show where the primers bind, with forward (sense) primers highlighted in purple and reverse (antisense) primers highlighted in orange.

PrimerMapResultsSequence

The second part of the results page show a table with all the primers that you input, highlighting which ones that bound with the color that indicates their orientation:

PrimerMapResultsTable

The only thing that is missing is a their column that indicates the position on the template at which the primers bind. I guess beggars can’t be choosers though.

Next time I’ll show you how to do this using NCBI’s Primer BLAST. This algorithm is actually build for primer design, but it can be hacked for this purpose and provides better visualizations and more information.

  • Tobin Magle, PhD, Biomedical Sciences Research Support Specialist